protien

Our academic experts are ready and waiting to assist with any writing project you may have. From simple essay plans, through to full dissertations, you can guarantee we have a service perfectly matched to your needs.

GET A 40% DISCOUNT ON YOU FIRST ORDER

ORDER NOW DISCOUNT CODE >>>> WELCOME40

Protein Synthesis Worksheet Using the DNA strand given across the top as the template, complete the worksheet on the next page, filling in the missing 1. bases in the complementary DNA strand, 2. the codons of the mRNA, 3. the anticodons of the tRNA, 4. the amino acid molecules (the resulting polypeptide.) Then try the following:  Mutate the 6th triplet in the DNA from CTT to CTC. What will the mRNA be now? What will the tRNA be? What will the amino acid be?  Now mutate the 6th triplet in the DNA from CTT to CAT. What will the mRNA be now? What will the tRNA be? What will the amino acid be? Does a point mutation always cause a “wrong” amino acid to be put into the polypeptide? In what case is the mutation more likely to do so? Write in the GTTCACTTA ComplementaryDNA CAAGTGAATTGTGGACTTCTC This is the DNA template strand GUUCACUUA Write in the mRNA (I did 3 for you.) CAAGUGAAU Write in the tRNA (I did 3 for you.) Val His Leu Write in the amino acids (I did 3 for you.) Result of mutating CTT to CTC Result of mutating CTT to CAT

Our academic experts are ready and waiting to assist with any writing project you may have. From simple essay plans, through to full dissertations, you can guarantee we have a service perfectly matched to your needs.

GET A 40% DISCOUNT ON YOU FIRST ORDER

ORDER NOW DISCOUNT CODE >>>> WELCOME40

 

 

Posted in Uncategorized